The Watcher
 Home | Statement of Faith | About Site | Links EMAIL | GUESTBOOK


 

 


the watcher

THE TWO BOOKS OF GOD

God has supplied man with two books, which contain His Word.

1. The instruction of life for the physical body.
2. The instruction and education for the spiritual soul through their spirit.

The Creator's Book in Man.   The genetic book in mankind.

The scientists of today call it ' The Book of Man.' In it is written the DNA Code of instructions, which is the language of life. This book of God's word is contained in every cell of the physical body of mankind and every animal and plant.
"For all flesh is NOT the same, but there is one kind for humans, another for beasts, another for birds, and another for fish."
1 Corinthians 15:39. Amplified Version.

The message of the genes is the Creator God's instructions planted in the body on how to manufacture and reproduce every part of the physical body. Scientists and Molecular Biologists are now able to read this message of the genes, and are recording it, setting it out in sentences, paragraphs and chapters. The genes themselves are like sentences. Several genes together make a paragraph, and many paragraphs of gene clusters make a chapter, and many chapters make a book, called a chromosome. A typical line would be printed in the following manner:-

GCTGTTCAACCACTAATAGGTAAGAAATCAT

Ten of these lines would be a quarter of a page of this 'book of man', and is read and coded automatically by all the components of the body.
The knowledge of this should make us rejoice along with the Psalmist in praise to God, the Creator. "I will confess and praise You, for You are fearfully wonderful, and for the awful wonder of my birth! Wonderful are Your works, and that my soul , inner self knows right well Your eyes saw my unformed substance, and in YOUR BOOK all the days of my LIFE were written, BEFORE ever they took shape, when as yet there was none of them." Psalm 139:13-17. Amp.

The Book for Man. The Bible FOR Mankind.

The Bible is a Library of 66 books, bound together in TWO volumes, the Hebrew writings and the Greek writings.

The Hebrew volume is primarily concerned with God's chosen people Israel. It relates to their history, prophecy, law and poetry.

The Greek volume deals first with the closing days of the Law to Israel, and can be found in the book of Matthew through to Acts. This is called the Transitional Period. Then inserted in the writings is the Parenthetic Epistles, which commences with the book of Romans through to Philemon. They were specifically written for the Parenthetic Ecclesia of today. They contain the doctrine and deportment of today's dispensation of God's grace.

AFTER the Ecclesia has been taken up out of this world, then God continues with His chosen people. From the book of Hebrews to Revelation the future plans for the Jews and the rest of the nations left in the world are revealed.

"Every scripture is God breathed - given by His inspiration - and profitable for instruction, for reproof and conviction of sin, for correction and error and discipline on obedience, and for training in righteousness; so that the man of God may be complete and proficient, well fitted and thoroughly equipped for every good work.." 2 Timothy 3: 15-17. Amp.

In Conclusion

The first book is planted in the physical body of man, animal and plant, which works automatically, fulfilling the plan and purpose of the Creator, unless it is tampered with by the so -called improvement by man

The second book is given only to mankind to read, learn, and accept God's Word of truth in obedience. To obey it's advice will bring peace and true satisfaction in this life, and after physical death, life everlasting.

To refuse it's advice and knowledge brings unrest and dissatisfaction in this life, and the awful separation from the Creator in the next world.

"For as much as was written BEFORE, was written FOR OUR TEACHING, that through the endurance and consolation of the Scriptures we may have expectation" Romans 15:4.